Aprinocarsen
Term · Oncology and biomedicine · MLC-T-ONC-011213
A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, aprinocarsen hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells.
| Identifier | MLC-T-ONC-011213 |
|---|---|
| Field | Oncology and biomedicine |
| Synonyms | DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA); protein kinase C-alpha antisense |
| References | National Cancer Institute Thesaurus (CC BY 4.0) |
Record as JSON
{
"id": "MLC-T-ONC-011213",
"term": "Aprinocarsen",
"field": "Oncology and biomedicine",
"definition": "A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, aprinocarsen hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells.",
"synonyms": [
"DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA)",
"protein kinase C-alpha antisense"
],
"references": [
"National Cancer Institute Thesaurus"
],
"url": "https://mlchart.com/terminology/oncology/aprinocarsen/"
}
Record 2,398 of 17,717 in Oncology and biomedicine terminology (MLC-0111). Request the full dataset.