MLchartDataset catalogue

Aprinocarsen

Term · Oncology and biomedicine · MLC-T-ONC-011213

A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, aprinocarsen hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells.

Table 1. Record
IdentifierMLC-T-ONC-011213
FieldOncology and biomedicine
SynonymsDNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA); protein kinase C-alpha antisense
ReferencesNational Cancer Institute Thesaurus (CC BY 4.0)
Record as JSON
{
  "id": "MLC-T-ONC-011213",
  "term": "Aprinocarsen",
  "field": "Oncology and biomedicine",
  "definition": "A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, aprinocarsen hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells.",
  "synonyms": [
    "DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA)",
    "protein kinase C-alpha antisense"
  ],
  "references": [
    "National Cancer Institute Thesaurus"
  ],
  "url": "https://mlchart.com/terminology/oncology/aprinocarsen/"
}

Record 2,398 of 17,717 in Oncology and biomedicine terminology (MLC-0111). Request the full dataset.